10th CSTEP Conference, Pierre

Presented at the 10th Annual Statewide CSTEP Conference,
April 2002

Isolation of a putative Arabidopsis indole pyruvate decarboxylase gene by RT-PCR. Pascale Pierre¹ and Jennifer Normanly,² ¹Department of Biology, Medgar Evers College Brooklyn, NY and ²the University of Massachusetts, Amherst, MA. Faculty Mentor: Mohsin Patwary.

Indole-3-acetic-acid (IAA), a plant growth-promoting factor, is believed to be synthesized from tryptophan. We studied one pathway involving indole-3-pyruvic acid decarboxylase (IPDC). E. coli lacks the IPDC gene and is unable to synthesize IAA unless the gene is expressed ectopically. Arabidopsis possess two genes resembling the microbial IPDC. We amplified them through RT-PCR. Total RNA was isolated from Arabidopsis frozen tissues using TRIZOL reagent. PCR reactions were tried using different primers, annealing temperatures and cycling conditions. We got a product using 5=T30-3 (AAGAATTCCAATGGACACCAAAATTGGA) and 3= T30-3 (AGCAGGAGGGTTAGGAGTCATCGAACT) primers, which were designed based on the coding sequence of Arabidopsis thaliana genes: T1O08-30 (Genbank: AL161746) and T1O08-40 (Genbank: AL161746). The PCR product was ligated into E. coli vectors and the mixture transferred into competent E. coli. Twelve positive colonies were amplified through liquid culture and plasmid DNAs were isolated. Three colonies had plasmids with inserts. Further work will concentrate on insert sequencing to verify the Arabidopsis T10O8 gene was successfully cloned.

Pascale Pierre is a participant in the Biology-CSTEP of MEC which is supported by NYSDOE grant 0516001058. She also was a participant in the Summer Research Experiences for Undergraduates (REU) Program of UMass at Amherst.

Return to 10th Annual CSTEP Conference